ID: 938307338_938307341

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 938307338 938307341
Species Human (GRCh38) Human (GRCh38)
Location 2:130264895-130264917 2:130264915-130264937
Sequence CCACAGATGGCCAGGGAATAGGA GGAAAACCCCACAGTGGAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!