ID: 938361850_938361862

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 938361850 938361862
Species Human (GRCh38) Human (GRCh38)
Location 2:130693634-130693656 2:130693665-130693687
Sequence CCCGCACGCTGTTGAGGTAGTCG CCTGGCCTCGGGCTCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 1, 4: 23} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!