ID: 938368846_938368851

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 938368846 938368851
Species Human (GRCh38) Human (GRCh38)
Location 2:130756272-130756294 2:130756310-130756332
Sequence CCGCGGCGCGCGGCGCCGGGAGC GCGCGGCTCGCGCTCCGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 282} {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!