ID: 938392385_938392390

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 938392385 938392390
Species Human (GRCh38) Human (GRCh38)
Location 2:130916143-130916165 2:130916165-130916187
Sequence CCGGGAGAGAGACTGCGTGGGGA AGAGCCGGAGCTCCGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 229} {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!