ID: 938436303_938436314

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 938436303 938436314
Species Human (GRCh38) Human (GRCh38)
Location 2:131285474-131285496 2:131285511-131285533
Sequence CCTGCCAGCCTTGTGCTCCCCAT CTTTTCCAGTGTCAGCCAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!