ID: 938444610_938444624

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 938444610 938444624
Species Human (GRCh38) Human (GRCh38)
Location 2:131367246-131367268 2:131367293-131367315
Sequence CCCGAAGCCTGGGAGCCCCAGGG GTCCCCAGAAGGGGTCAACATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 78, 4: 582} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!