ID: 938469374_938469384

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 938469374 938469384
Species Human (GRCh38) Human (GRCh38)
Location 2:131544811-131544833 2:131544846-131544868
Sequence CCAAGGAGTGCAGCCCTGGTGGG TGGCCAGTTGCACCTGGATGGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!