ID: 938536888_938536899

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 938536888 938536899
Species Human (GRCh38) Human (GRCh38)
Location 2:132255045-132255067 2:132255098-132255120
Sequence CCCAAAAACCCAAAGACTGGTTT AACACCGCCACATCGCCAGTTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 17, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!