ID: 938537218_938537226

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 938537218 938537226
Species Human (GRCh38) Human (GRCh38)
Location 2:132256714-132256736 2:132256737-132256759
Sequence CCCACTCGGGGTGCCGCCGACCT GGTCCCGAAGGCGCACGCCCGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 4, 4: 44} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!