ID: 938541298_938541305

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 938541298 938541305
Species Human (GRCh38) Human (GRCh38)
Location 2:132286163-132286185 2:132286211-132286233
Sequence CCTGGGTGGTGATATCAGCCATT GTGTGACAGTAGCAAGTAGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 10, 4: 106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!