ID: 938583673_938583690

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 938583673 938583690
Species Human (GRCh38) Human (GRCh38)
Location 2:132669732-132669754 2:132669778-132669800
Sequence CCCCGGGGCACCAGTCGCGGCCG GCGCAGGGCTGGCCCCGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 67} {0: 1, 1: 0, 2: 5, 3: 34, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!