ID: 938606624_938606629

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 938606624 938606629
Species Human (GRCh38) Human (GRCh38)
Location 2:132900055-132900077 2:132900101-132900123
Sequence CCAGTTGGTGGTGCACTCAGAAC CCTTATATAGGTGTGCTTCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 70, 3: 153, 4: 340} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!