ID: 938794590_938794596

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 938794590 938794596
Species Human (GRCh38) Human (GRCh38)
Location 2:134706997-134707019 2:134707010-134707032
Sequence CCCTCCTGGTCCCCACCTCTCAG CACCTCTCAGAAGCAGCCTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!