ID: 938873868_938873874

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 938873868 938873874
Species Human (GRCh38) Human (GRCh38)
Location 2:135511814-135511836 2:135511844-135511866
Sequence CCCCATGGACATAAGAAGAGTTC AAAATCTATGCAGCATGTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!