ID: 938912873_938912877

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 938912873 938912877
Species Human (GRCh38) Human (GRCh38)
Location 2:135901483-135901505 2:135901509-135901531
Sequence CCATGTGAGGATACAGCATTTAT CTCCAGAGGATGCAGCAACAAGG
Strand - +
Off-target summary {0: 2, 1: 11, 2: 73, 3: 234, 4: 735} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!