ID: 939080410_939080411

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 939080410 939080411
Species Human (GRCh38) Human (GRCh38)
Location 2:137654297-137654319 2:137654313-137654335
Sequence CCTACAGCGTGGTACTGCTGAAC GCTGAACAGCCACTTTGACTTGG
Strand - +
Off-target summary No data {0: 2, 1: 6, 2: 33, 3: 81, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!