ID: 939153956_939153966

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 939153956 939153966
Species Human (GRCh38) Human (GRCh38)
Location 2:138502227-138502249 2:138502261-138502283
Sequence CCTCTGCTCTCTGGGTCCCGGAC CGGCGAGCTCCGGCCTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 237} {0: 1, 1: 0, 2: 1, 3: 4, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!