ID: 939168829_939168832

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 939168829 939168832
Species Human (GRCh38) Human (GRCh38)
Location 2:138670313-138670335 2:138670336-138670358
Sequence CCACGCAACTGTAGCTCAGATGA TAAGGAACTTGGTTCCACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 0, 2: 2, 3: 11, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!