ID: 939178605_939178617

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 939178605 939178617
Species Human (GRCh38) Human (GRCh38)
Location 2:138780190-138780212 2:138780231-138780253
Sequence CCAGCTGCAGCAAGCCAGGGACC CGCAGGCGCATGGTGCCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 306} {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!