ID: 939224986_939224996

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 939224986 939224996
Species Human (GRCh38) Human (GRCh38)
Location 2:139353697-139353719 2:139353746-139353768
Sequence CCGTGCTGTGTGTGTGCAGCCTA ACTCCAGCTATGGCTAAAATTGG
Strand - +
Off-target summary No data {0: 1, 1: 12, 2: 229, 3: 1153, 4: 1796}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!