ID: 939494101_939494109

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 939494101 939494109
Species Human (GRCh38) Human (GRCh38)
Location 2:142907459-142907481 2:142907501-142907523
Sequence CCAGATCCAGAGGGGTGGGAGTC TGGCAAATAGCAGTTGTGGATGG
Strand - +
Off-target summary {0: 2, 1: 31, 2: 85, 3: 103, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!