ID: 939551509_939551512

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 939551509 939551512
Species Human (GRCh38) Human (GRCh38)
Location 2:143621355-143621377 2:143621375-143621397
Sequence CCTGTTAACACCAGGGTAGGGTT GTTATGGTTAGTTCATCTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!