ID: 939618511_939618520

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 939618511 939618520
Species Human (GRCh38) Human (GRCh38)
Location 2:144389279-144389301 2:144389326-144389348
Sequence CCCAGCTCCAACTCCGTCTACAT TGTCCCTCTCTACAGCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 118} {0: 1, 1: 0, 2: 3, 3: 20, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!