ID: 939651286_939651288

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 939651286 939651288
Species Human (GRCh38) Human (GRCh38)
Location 2:144765669-144765691 2:144765691-144765713
Sequence CCAAGCTCTATCTGTCTATAAAG GACCTTGCTATATTTCTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 255} {0: 1, 1: 0, 2: 1, 3: 10, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!