ID: 939788684_939788688

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 939788684 939788688
Species Human (GRCh38) Human (GRCh38)
Location 2:146546103-146546125 2:146546142-146546164
Sequence CCCAGTAACAGGCCAAGAGTTGT AGTTATCTGCAGAAGATGCCAGG
Strand - +
Off-target summary {0: 17, 1: 184, 2: 186, 3: 148, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!