ID: 939788685_939788688

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 939788685 939788688
Species Human (GRCh38) Human (GRCh38)
Location 2:146546104-146546126 2:146546142-146546164
Sequence CCAGTAACAGGCCAAGAGTTGTC AGTTATCTGCAGAAGATGCCAGG
Strand - +
Off-target summary {0: 17, 1: 171, 2: 183, 3: 131, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!