ID: 939853604_939853607

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 939853604 939853607
Species Human (GRCh38) Human (GRCh38)
Location 2:147329980-147330002 2:147330027-147330049
Sequence CCTGTGTAGGGCTAAACGCAGCC TAGTTTATTATCTCTGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!