ID: 939993445_939993457

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 939993445 939993457
Species Human (GRCh38) Human (GRCh38)
Location 2:148898127-148898149 2:148898173-148898195
Sequence CCTAGCCCTCCCTTCCTGCCAAA ATGGAGACCTTCAGGCACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 446} {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!