ID: 940049885_940049887

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 940049885 940049887
Species Human (GRCh38) Human (GRCh38)
Location 2:149451139-149451161 2:149451183-149451205
Sequence CCGGCAGGTTCTAGAAGGGCATA CACCTTGCTGCTGCATCCTCTGG
Strand - +
Off-target summary No data {0: 2, 1: 11, 2: 26, 3: 107, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!