ID: 940049885_940049887 |
View in Genome Browser |
Spacer: 21 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 940049885 | 940049887 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:149451139-149451161 | 2:149451183-149451205 |
| Sequence | CCGGCAGGTTCTAGAAGGGCATA | CACCTTGCTGCTGCATCCTCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 11, 2: 26, 3: 107, 4: 336} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||