ID: 940120021_940120029

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 940120021 940120029
Species Human (GRCh38) Human (GRCh38)
Location 2:150253938-150253960 2:150253978-150254000
Sequence CCCTGGAAGAGCTGCATATAAGG GTTAGTAGAGGAAACTCCAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!