ID: 940144158_940144162

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 940144158 940144162
Species Human (GRCh38) Human (GRCh38)
Location 2:150527813-150527835 2:150527843-150527865
Sequence CCCTGACAATTCCACAAGCACAG CACCTGTAATCCCAGAACTTTGG
Strand - +
Off-target summary No data {0: 1535, 1: 75870, 2: 213055, 3: 254444, 4: 203232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!