|
Left Crispr |
Right Crispr |
Crispr ID |
940144158 |
940144162 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:150527813-150527835
|
2:150527843-150527865
|
Sequence |
CCCTGACAATTCCACAAGCACAG |
CACCTGTAATCCCAGAACTTTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 1535, 1: 75870, 2: 213055, 3: 254444, 4: 203232} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|