ID: 940237316_940237322

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 940237316 940237322
Species Human (GRCh38) Human (GRCh38)
Location 2:151525444-151525466 2:151525467-151525489
Sequence CCAACACTAGAACCACCTGGCAA TCTTCGGAGAACCTGGGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141} {0: 1, 1: 0, 2: 0, 3: 9, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!