ID: 940241537_940241545

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 940241537 940241545
Species Human (GRCh38) Human (GRCh38)
Location 2:151568309-151568331 2:151568336-151568358
Sequence CCCATACCTGGTCCAGTATCCTA CCTCCTGGGCAGTGTGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76} {0: 1, 1: 0, 2: 1, 3: 47, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!