ID: 940253807_940253815

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 940253807 940253815
Species Human (GRCh38) Human (GRCh38)
Location 2:151708104-151708126 2:151708157-151708179
Sequence CCTTCCACCTGCTCTAGGATATC ACCAAATCTTCCCTTTCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 245} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!