ID: 940357107_940357113

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 940357107 940357113
Species Human (GRCh38) Human (GRCh38)
Location 2:152755342-152755364 2:152755374-152755396
Sequence CCTCCACCTCTTGTGGAGGGCCT CAGGCCCGCCTGCAGTTATCCGG
Strand - +
Off-target summary No data {0: 4, 1: 36, 2: 89, 3: 131, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!