ID: 940396913_940396920

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 940396913 940396920
Species Human (GRCh38) Human (GRCh38)
Location 2:153200127-153200149 2:153200180-153200202
Sequence CCTCGGCTTCTGAACCTCACCCT GAGGATAAACTGAAGCAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 92, 4: 824}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!