ID: 940403852_940403859

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 940403852 940403859
Species Human (GRCh38) Human (GRCh38)
Location 2:153278187-153278209 2:153278227-153278249
Sequence CCTCCCAAAGTGCTGGGATTACA TTAAGTTTCTTAAAGTTTCAGGG
Strand - +
Off-target summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!