ID: 940453711_940453719

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 940453711 940453719
Species Human (GRCh38) Human (GRCh38)
Location 2:153871810-153871832 2:153871826-153871848
Sequence CCCAGTGAGAGGCCTCCAGGCTG CAGGCTGGGGCTACGAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 232} {0: 1, 1: 0, 2: 1, 3: 24, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!