ID: 940502329_940502336

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 940502329 940502336
Species Human (GRCh38) Human (GRCh38)
Location 2:154508467-154508489 2:154508498-154508520
Sequence CCTCGGCCTCCCAAAGTACTGGG CATGAGCCACCGTGCCCGGCCGG
Strand - +
Off-target summary {0: 2664, 1: 125841, 2: 272203, 3: 213195, 4: 126814} {0: 115, 1: 1009, 2: 3849, 3: 6107, 4: 7044}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!