ID: 940502331_940502335

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 940502331 940502335
Species Human (GRCh38) Human (GRCh38)
Location 2:154508473-154508495 2:154508494-154508516
Sequence CCTCCCAAAGTACTGGGATTACA CAGGCATGAGCCACCGTGCCCGG
Strand - +
Off-target summary {0: 8216, 1: 308215, 2: 267713, 3: 148631, 4: 131048} {0: 6929, 1: 41657, 2: 112181, 3: 156808, 4: 166907}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!