ID: 940502333_940502335

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 940502333 940502335
Species Human (GRCh38) Human (GRCh38)
Location 2:154508476-154508498 2:154508494-154508516
Sequence CCCAAAGTACTGGGATTACAGGC CAGGCATGAGCCACCGTGCCCGG
Strand - +
Off-target summary {0: 5907, 1: 232259, 2: 277417, 3: 182413, 4: 140180} {0: 6929, 1: 41657, 2: 112181, 3: 156808, 4: 166907}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!