ID: 940564255_940564259

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 940564255 940564259
Species Human (GRCh38) Human (GRCh38)
Location 2:155340210-155340232 2:155340227-155340249
Sequence CCAGTTGTCCTCTAGATTAGCTG TAGCTGCTGCCATGGGCCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 40, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!