ID: 940656162_940656175

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 940656162 940656175
Species Human (GRCh38) Human (GRCh38)
Location 2:156489939-156489961 2:156489972-156489994
Sequence CCCTCCCACTACCCCCTCTCCCT TTCGGTCTCCCAGTTAATATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 209, 4: 1804} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!