ID: 940726790_940726791

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 940726790 940726791
Species Human (GRCh38) Human (GRCh38)
Location 2:157343879-157343901 2:157343914-157343936
Sequence CCATGAATAGCAGTGAAAGGTTA ATGTGCTTTCTTATACACCATGG
Strand - +
Off-target summary {0: 12, 1: 8, 2: 7, 3: 23, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!