ID: 940728305_940728309

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 940728305 940728309
Species Human (GRCh38) Human (GRCh38)
Location 2:157361030-157361052 2:157361071-157361093
Sequence CCAGTCACGTGGAACTGTGAGTC TAGAAATTATACAATCTCAGGGG
Strand - +
Off-target summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!