ID: 940737440_940737445

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 940737440 940737445
Species Human (GRCh38) Human (GRCh38)
Location 2:157469337-157469359 2:157469379-157469401
Sequence CCCCCAAAGTGTTCCATGTTCTA ATCTAGTTCTAGAAGTATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 709} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!