ID: 940756259_940756262

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 940756259 940756262
Species Human (GRCh38) Human (GRCh38)
Location 2:157686540-157686562 2:157686585-157686607
Sequence CCAAGAAATAGGTATTGTACTAG CAAAACAGTCCCTGCCCTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 46, 3: 282, 4: 1202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!