ID: 940764759_940764771

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 940764759 940764771
Species Human (GRCh38) Human (GRCh38)
Location 2:157778300-157778322 2:157778341-157778363
Sequence CCAACCTCCAAGTGGAAATTCTG TCCTGGAGTTGGAGGGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 179} {0: 1, 1: 1, 2: 2, 3: 34, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!