ID: 940775013_940775027

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 940775013 940775027
Species Human (GRCh38) Human (GRCh38)
Location 2:157876090-157876112 2:157876122-157876144
Sequence CCGGGGGAAAGAGCCGGGGGAGG CGGGGTGAAGAGGAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 359} {0: 1, 1: 1, 2: 14, 3: 194, 4: 1814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!