ID: 940816326_940816334

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 940816326 940816334
Species Human (GRCh38) Human (GRCh38)
Location 2:158301767-158301789 2:158301812-158301834
Sequence CCAGGAGGATCAGGATGGAAGAG GTGGTCACTGGAGACCTTAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!